Franco File

Bring in the Snark (or Bringin da Snark...WORDPLAY!)

2010-10-01T09:07:00.004-04:00

Dear pretty girl walking to the T in front of me in Somerville today,

I know you've been waiting until October 1st to wear that pumpkin-colored blouse you bought way back in April. And I commend you for pairing it with a smart, pinstriped black slack for work today. Here's the middle of the compliment sandwich: your turquoise flip-flops and copy of Atlas Shrugged. Allow me to deal with these in bullet-point form, similar to an "action item list" or whatever jargon-based "To Do List" your self-important company chooses to use (which is most likely in finance...offffff course):

a) It's supposed to pour today...all day...nonstop. You'll find that your rubber-based, open-toed choice of footwear will equal EPIC FAIL later on.

b) No one's buying it. People don't read Atlas Shrugged on a subway. People show other people that they are reading Atlas Shrugged on a subway. Unless you're some Tea Party nutbag or your last name is actually Galt or Rand or Beck, perhaps you'll enjoy Nicholas Sparks' latest yarn about two people who fall in love when they're little, are separated for most of their adult lives, and then come back together, fall in love, and one of them dies in a plane crash into the ocean being eaten by sharks....but sharks that are in love.

c) You are exactly what is destroying America. Please stop. For all of us.

Sincerely
-Tim

PS: Compliment sandwich, right. You walked quickly on the sidewalk, and I appreciate that. Although, you shouldn't be rewarded for doing what you're fucking supposed to be doing, so...backhanded compliment sandwich. BAAAAAAAAAAAANG!

Science LULZ!

2010-09-30T16:29:00.000-04:00

One megaphone = 10^12 microphones.

Science in the 21st Century

2010-09-30T14:16:00.001-04:00

Quote of the day:

Science is not meant to be done in 160 characters or less.

That is all.

It's not procrastination....

2010-09-17T10:34:00.002-04:00

Today's words of wisdom: Every journey begins with thinking about taking the first step.

Possible Foray into Creative Writing?

2010-09-15T16:41:00.003-04:00

On Tuesdays in the spr-umm-all (June 15-October 26) there is a farmer's market outside my building with delicious baked goods. I went to go get a chocolate chip cookie yesterday when it randomly decided to pour for 10 minutes. I aborted the mission and came back inside. Here's the google chat that ensued:

me: a torrential downpour just thwarted my cookie purchasing

1:10 PM Kally: that is an excellent sentence.

that's the beginning of a really funny story.

1:11 PM like. in a book.

i'm not demanding that you tell me a story.

1:12 PM me: It was a dark and stormy night.

A torrential downpour just thwarted my cookie purchasing.

1:13 PM Kally: yes. exactly.

that is comedy gold.

or. you know. it could be.

1:14 PM me: It was a dark and stormy night.
A torrential downpour just thwarted my cookie purchasing. Now Livinia will certainly divorce me.

1:15 PM Or worse, send me back out in a second attempt

Cookies and I have never gotten along.

Ever.

1:16 PM Ever since my first lunch in kindergarten, when Steven Billings took my perfectly packaged oreos out of my lunch for "bully tax".

Straight through today...per usual.

Physics is EVERYWHERE!

2010-08-26T13:37:00.001-04:00

"we are watching man v. food, and the host is about to devour an enormous pancake. he said, “I’ve never had a pancake with it’s own gravitational pull!”
Tim, the Harvard physics professor, said, “that’s not true. everything has a gravitational pull.”
duh, competitive eating show host. duh."

Bored at work, you say?/Thank god for teh internetz/I can haz haikuz?

2010-05-20T14:48:00.002-04:00

I was bored at work today and decided to write some haikus.

Like, I Majored in Haiku, That's How Good
i’m good at haikus
now what should I write about
hey! look what I did!

The Work Man’s Burden
it’s fucking hot out
falling asleep at my desk
fuck my life so hard

The Hot Topic Anthem
the world is so grey
raindrops like tears on pillows
brb must cut

Overrated
new york smells like pee
urban decay and hipsters
nothing but douchebags

I Need an Appointment Today!
can you fit me in?
that’s what she said, no really
she’s a wicked whore

I’ll Do Myself Later
procrastination
like masturbating
only fucking self

Nerds! Nerds! Nerds!
recursive haiku
goes around in a circle
recursive haiku!

I’m Going to Hell
ass, cock, balls, douchebag
fuckity fucking fuck fuck
tourette’s for the win

Love and Loss
the blue sky today
reminds me of your bright eyes
lost and gone for good

An Ode to Adam Wheeler
of course you got caught
classical armenian?
are you shitting me?

A Haiku Made of Metal and Brawn
it stings the nostrils
right to the babymaker
milk was a bad choice

Which is Why I’m So Good at It
fantasy baseball
statistics and trash talking
nerd version of sports

BUT I CAN’T TURN AROUND!
GPS system
Should I turn yet? Maybe here?
STOP YELLING AT ME!

Oh, and the Therapy Bills
happy parents day!
thanks for the guilt and being
passive aggressive

Bourbon Street Theology
poverty and floods
hurricanes and oil spills
god hates new orleans

Boston, You’re My Home
Nice day at Fenway!
I love that dirty water
Go Red Sox, NOMAHHHHHH!

Where’s Its Leash?
30 and single
shut up about your kids
no, i bet they’re great

When furniture attacks....

2010-05-07T12:00:00.001-04:00

Kally: ...oh god. to somewhere specific? is he going to couch surf?

me: couch surg

Kally: i only ask because my brother would definitely do that

me: -g

OH MY GOD RUNNNNN!

Kally: is he going to surf on our couch?

me: THE COUCHES ARE SURGING!

AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH

Kally: IT'S A BLITZ!!!

(alolling.)

70 points, if you're wondering

2010-04-12T11:53:00.001-04:00

I just bingoed in my Scrabble game.
The word, you ask?
...

A-B-O-R-T-I-O-N.

Apparently I'm playing soshulist trrrst Obamer scrabbbbbble.

Cats and Dogs, Part 2

2010-04-05T10:47:00.002-04:00

me: I WANT A CAT

NOW

CATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT

Kally: 3 months. 3 months, tim

me: no, i want a cat for years not just months

that sounds like a rent-a-cat

Kally: IN 3 months.

in 3 months you can have a cat for years.

me: maybe there's some rentacat black market that you've stumbled onto

all types of opus dei and shit

Kally: hahahahaha

you meet in dark alleys

exchange money

me: Tom Hanks shows up to do some puzzles

Kally: and take your cat to a hotel room to play with catnip.

me: There's some evil albino mexican hairless self-flagellating

Kally: is that like dr. evil's cat?

me: yeah

well, but a dog

http://www.dogbreedinfo.com/images10/XoloJune1Gather29.JPG

Kally: oh i get it, mexican hairless dog.

me: of course the dog is the evil bad guy

and dog bkwds is god

dan brown reference...so....

Kally: not like silas, who was actually spanish in the book...

and albino.

probably not hairless...

me: probably

Change of clothes, Aisle 1

2010-04-05T10:36:00.002-04:00

I was waiting for the train at Downtown Crossing today, and was reading my magazine, as I am wont to do. The train pulls into the station, and I don't pay super attention to it...since I do this every day. The car I wait for is the one with the conductor in it, towards the end of the train. At that point the train is pretty much stopped when the guy goes past me. Today, he jokingly grabbed at my magazine and said "gimme that book".

SCARED THE FUCK OUT OF ME....today's been a super day.

Sillyectomy?

2010-03-23T21:38:00.003-04:00

(Background: I got sick in the final 12 hours of spring break...just in time for work on Monday and a lecture this morning that I had to give. This illness is on top of the oral surgery I had on Wednesday. My body has officially given up for the week.)

Kally: well.

that's the point of a fever. it's just making your body inhospitable to germs

so if your fever broke early then your body assessed that there wasn't much need

i also imagine that the antibiotics you're on helped.

me: ABORT ABORT ABORT

that's what just played in my head when i read your response

i thought the antibiotics would have helped earlier....unless i have the flu...ugh

Kally: do you really think you speak english at a cellular level?

me: oh, i guess a cold virus

my cells are jingoistic bastards

Kally: that fever is making your silly.

you.

not your.

i don't even know if you HAVE a silly.

me: no, the fact that now i have to answer 10 emails and read 50 some odd survey responses is what's doing it

i had my silly removed when i was younger

Kally: sorry, just alolling over here. (Ed. Note: Alol is an internetism DR and I made up to stand for "actually laughing out loud".)

me: i heard

Kally: i think your silly has grown back.

me: i think i had more than one

like siamese sillys

Kally: TIM.

that is not PC

they are conjoined sillies.

me: fine

thai sillys

So this is what socialism feels like

2010-03-22T13:27:00.002-04:00

...I expected it to involve more soldiers...

My internet fame is growing. Been RT'ed by 2, count 'em, 2 strangers:

BotticusMaximus: Be sure to hide your grandparents in your panic room before Obama rounds them up for the ritualistic killings at dusk #hcr

From elsewhere on teh Interwebz:

The Secret Service will be busy today

Anti-abortion Stupak a "Baby Killer"? I assume we already have different definitions on "fetus", but I must have a different definition of "abortion" or "killer"....

It bothers me that Dr. Keith Ablow lives in Newburyport. It bothers me more that he's thinking of running for office. But, I guess if Jerry Springer can do it....

Facebook: The microcosm of debate

Representative Crazy Pants

I don't actually want to know what that entails

2010-02-25T09:12:00.002-05:00

http://thinkprogress.org/2010/02/22/wargotz-obama-birther/
(Link from DR)

Apparently the self-called "presumptive nominee" for the Maryland US Senate race is a birther. Doing some hard-hitting research, I looked up what he did...on the biography page of his website:

"Dr. Wargotz is a recognized expert in pathology of the Breast and Gynecological Tract."

Let me translate that in non-science speak--"Dr. Wargotz shtoops broads"

DR also pointed out that he is the "goofiest looking dbag i've seen in a while". My answer?
"And you live in Allston...HEY YOOOOOOOOOOO!"

It's 915A, I've had zero coffee, and I'm on FIRE!

Harvard Mentality

2010-02-19T12:03:00.001-05:00

"Obviously she was very distraught and concerned over that tenure," Miller said.

"It insulted her and slapped her in the face, and it's probably tied in with the Harvard mentality. She brooded and brooded and brooded over it, and then, 'bingo.'"

...and slap the dick out of your mouth.

2010-02-10T17:40:00.002-05:00

I'm writing a lab handout/procedure on the gas-phase infrared spectrum of HCl, which gives us information on the vibrational frequency of the hydrogen-chlorine bond. Microsoft Word suggested i change the word "vibrational" to "irrational". I don't go to Seattle and judge Bill Gates' choice of profession....

Portmanteaux

2010-02-03T11:53:00.002-05:00

I'm a large fan of portmanteaux, combining words to make up new words.
Today's portmanteau is inspired by a story from DR, who just helped a woman who makes $200k remove a page from a Microsoft Word document (by deleting it, i imagine).

ameritocracy: (n.) /ah-meh-rih-TOK-rah-cee/ The system in place in corporate America in which people do not deserve the position/salary they presently have, promotions are given based on networking and other invented corporate-speak, and intelligence is not rewarded (and possibly even penalized).

That's not a euphemism

2010-01-25T12:49:00.000-05:00

Kally: my chipotle boyfriend is unhinged.
me: ...

<--not shocked

he's set himself up in a relationship based on unrequited love

and he brings free burritos to the table

...literally

he literally brings burritos to your table

Kally: hahahahahahahahaha

Jabba the Fucking Hutt

2010-01-19T10:02:00.002-05:00

Apparently Kally didn't know that I know things about Star Wars. To be fair, I've only seen 2/6 of the movies (Episodes IV, I). I have many common references/terms related to Star Wars though. For example, I refer to Central Square as Mos Eisley since "[y]ou will never find a more wretched hive of scum and villainy." When morbidly obese people take up more than their one allotted seat on the subway, that is known as "Jabbaing" onto me or my seat.
Below is a conversation we had this morning....

me: i didn't sleep well last night, so i admit i'm pretty cranky but i almost stabbed 3 people on the train today

Kally: for any particular reason? or just cause?

me: oh they know what they did

Kally: let's be honest, tim. they probably don't.

me: one lady was taking up 1.5 seats on the train and refused to make an effort to not be morbidly obese another guy in front of me was goosestepping while walking thru the station and up the stairs so he almost punched me in the face every time with every stride he took

Kally: not that i'm excusing the offense or anything, but it takes a bit of time and
concentration to become not morbidly obese. probably more than a train-ride.

...so his offense was being a nazi. got it.

me: yeah, probably, but she didn't even TRY

Kally: being a nazi is a stabbable offense, i feel. and if you stabbed the morbidly obese woman, you would have just lost your knife.

me: true but she prolly would have lost some weight since it would just ooze out unless it's like a can of juicy juice and you need to pop open another part to have the air pressure push it out

unlucky for her i'm a scientist...lucky for her, i didn't have a fat opener

Kally: can you imagine the noise? not the popping noise, i don't even want to think about that.

but the deflating balloon noise. just a big, long, continuous fart noise.

for your sake, i hope she doesn't go flying around the train as she deflates...

except that if she did, you'd get a seat.

me: it'd sound like a whoopie cushion

Kally: a really soggy whoopie cushion...a whoopie cushion filled with fat.

me: a whoopie cushion mixed with the sound of the gore bag from my video game [Ed. note: Fallout 3]

Kally: ew. EW. that is not ok.

me: tell her to stop being jabba the fucking hutt with my subway seat

Course Evaluations

2010-01-15T09:39:00.004-05:00

We got our course eval's from last semester today. I, personally, did well on mine, but the class as a whole got reamed.
Here's a snippet of some responses:

which is just gross
"Few people know Newton's fourth law: that physics sucks. This course made an admirable attempt to make physics not suck, but this cannot be done as it would violate the laws of physics. They did come close to disproving Newton's fourth law, but then the final happened. Now every time I see a spring I cringe in horror and flee the premises (I used to love springs because they are so bouncy. But now they have periods and stuff which is just gross) PS. Even if you tend to do well in science classes don't take this course lightly. It takes work."

That's what we strive for. Not being the worst.
"Lots of work, must put in a good amount of effort, but not the worst pre-med class ever."

No comment
"Pain in the ass, but it's filled with dumbass premeds so it's better than 11a."

Tim's helpful and all, but in small doses.
"Labs can be pretty bad but Tim is really helpful, and at least they're not every week."

I knew that section on gay energy surfaces was a little much
"Its not just straight physics, which I might actually have preferred."

*check*
"It's a good course, but can get a little difficult towards the end. "

And I'm afraid that you're now a little bit closer to being a doctor
"DON'T TAKE THIS COURSE if you're not PreMed and fearful of taking Physics 11. I mean it was painful. Truly a painful experience for me. In other words I was only able to get through it by reminding myself that this is just something ridiculous that admissions offices are requiring me to do for medical school and that by doing this I'm a little bit closer to being a doctor."

(A) I think you mean "disincentivizes" if you're going to use made-up business slang and (B) wait, what?
"Also the grading scheme (uncurved) disincentives striving for an A which is messed up."

Ahhhhhh...why I don't go to the doctor...ever.

What is going on today?!

2010-01-11T16:53:00.003-05:00

I hurt my foot last week somehow...no clue. Just started gradually hurt more and more all of last week until it became almost unbearable to put pressure on it. It was a little better this morning...which makes sense because I planned on going to the doctor about it, so of course it doesn't hurt as much...of course.
I walked (read: hobbled) over to the infirmary to make an appointment at 1P. The receptionist asks if i'd like an appointment at 4P or wait to see the triage nurse. I say, 4P. She overrides my vote and says that there's only 1 person ahead of me and I should wait for the triage nurse. I sheepishly acquiesce and sit down. About 10 minutes later, my name's called and the nurse asks why I'm there. I describe my pain and start to undo my boot...when she stops me and says "You don't need to do that." ... Come again? (TWSS) You're a nurse...you asked me what's wrong...and you don't want to see it? (TWSS...NO TIME, NO TIME!) She took my blood pressure and temperature, apparently necessary for foot pain, and sent me back out in the waiting room and said I should expect to see someone at 15oP...i.e., 35 minutes. How stupid of me to have forgotten the pre-nurse portion of the medical experience.
So 150ish rolls around, get called in. He actually takes a look at my foot, which was reassuring. What made the situation hilarious was having my boot/sock off and he had my foot in his lap

and was rubbing it with his finger/thumb to feel where something was wrong. If someone had walked in, all they would have seen is me getting an awkward foot massage while he was trying to get to know me a little better by talking about my job. Super.
Long story short, there's no reason my foot should hurt and there's not a whole lot to do about it, which I knew/expected.
On top of this, Sarah Palin got a television deal, Mark McGwire admitted to steroid use, Simon Cowell is quitting American Idol, and for some reason Jay Leno is getting his time slot back. I hope Conan fucks NBC over so hard they can't walk for days. That's what she said, indeed.

...so there's that

2010-01-06T14:19:00.001-05:00

I used extremely broken Spanish to direct a woman to Walgreens this morning. Was walking to the T and she said, “Excuse me….Walgreens?”…in English. A perfectly fine English sentence. So I explained to her that it’s just down the street on the left (we were in front of the fire station at Centre and Jackson). She then said, in English, “I don’t speak English”. Which is true, except for the 2 sentences she’s apparently memorized. I’ll grant you “I don’t speak English” is a useful one, but she’s not going to get much life out of “Excuse me….Walgreens”, well…unless she has constant medical problems and then “excuse me…hospital” might be more useful.

The one positive out of that exchange is that I relearned the word for “traffic signal”—semaforo. So there’s that.

One to nuthin

2009-04-13T13:33:00.001-04:00

I finally won the Overheard in New York headline contest. Here's my entry:

I See Trashy People

Jersey girl #1: You know, I've always wondered how New Yorkers know when you're not from here.
Jersey girl #2: I know! It's like they have a sixth sense or something.
--Times Square
Headline by: Botticus

http://www.overheardinnewyork.com/archives/018675.html

God, I'm so awesome.

Brushes with fame

2009-02-14T13:53:00.004-05:00

I think i'm funny. Sometimes other people do too. Twice a week I enter into the Overheard in New York Caption Contest. I also submit entries to the Boston Globe's Cartoon Caption Contest. I've never won outright, but I have had a few honorable mentions--two each, to be precise. Here's my latest from the Globe (with the winning caption also):

(I don't have a picture of my first honorable mention, but it happened in mid-November 2008.) Here are my Overheard in NY attempts (with the winning title shown as a hyperlink):

The Glass Is Half Full and Half AIDS

Dude #1: If I was the last man on earth, I would die of exhaustion from banging too much!
Dude #2: If I was the last man on earth, I'd die of AIDS from banging too much.
--Battery Park

· "If I'm goin' everyone else is coming with me" - Botticus

See What You've Started, Beyonce?

Guy #1, yelling: Fuck yeah! Put that one in the satchel!
Guy #2: That had "skankalicious" written all over it.
--35th & 7th

· "Someone Tell Fergie to Stop Making Up Song Titles" - Botticus

If this whole professor thing doesn't work out, maybe i'll head out to the left coast and try writing sitcoms.

Stupid Macbook

2009-02-04T20:12:00.006-05:00

This is what I think about my stupid, albeit free, MacBook....

Love and Some Verses

2009-02-03T16:39:00.000-05:00

RULES:
1. Put your MP3 player, iTunes, Windows Media Player, etc. on shuffle.
2. For each question, press the next button to get your answer.
3. YOU MUST WRITE THAT SONG NAME DOWN NO MATTER HOW SILLY IT SOUNDS.
-------------------------------------------------------------------------------------------------------------

IF SOMEONE SAYS 'ARE YOU OKAY' YOU SAY?
Saca la Semilla - Tony Touch
(A--wow, we're going to start with embarassing? What did I do to wrong you iPod?)
(B--Apparently, i'm a giant, spanish-speaking pothead)
(C--For the record, I'm not a giant, spanish-speaking pothead)

HOW WOULD YOU DESCRIBE YOURSELF
The Same Boy You've Always Known - The White Stripes
(This is both precious and depressing, since apparently I don't change.)

WHAT DO YOU LIKE IN A GUY/GIRL?
Odalisque - The Decemberists
(I DO love Turkish hookers! Thanks iPod!)

HOW DO YOU FEEL TODAY?
Breakfast at Tiffany's - Cover by Rockapella
(A--I don't even eat breakfast)
(B--Yes, Rockapella, as in "Where in the world is Carmen Sandiego?". Suck it monkeys!)

WHAT IS YOUR LIFE'S PURPOSE?
Rain King - Counting Crows
(Apparently, I am the king of the rain.)

WHAT'S YOUR MOTTO?
Time of My Life - H-Blockx
(I'm really not this exciting.)

WHAT DO YOUR FRIENDS THINK OF YOU?
Giving Up - Silverstein
(Wow...epic fail.)

WHAT DO YOUR PARENTS THINK OF YOU?
Ya Vas Lyubeil - Oleg Pagudin
(This is a Pushkin poem that is often sung in Russian culture. It translates "I loved you". Note the past tense and the use of the formal "you". Again, epic fail.)

WHAT DO YOU THINK ABOUT VERY OFTEN?
Tiebreaker - The Nortons
(Ironic, since I can't play any sports. The Nortons were a local band I found in New Haven.)

WHAT IS 2 + 2?
Santa Fe - Rent
(You teach? Yeah, I teach. Not computer age philosophy....)

WHAT DO YOU THINK OF YOUR BEST FRIEND?
I Still Believe - Miss Saigon
(Not only as my iPod outed my love of reggaeton, but now it's working on my love of musical theatre. Super.)

WHAT IS YOUR LIFE STORY?
Goodnight Elisabeth - Counting Crows
(A--My shuffle apparently sucks, which I already knew.)
(B--Still king of the rain.)

WHAT DO YOU WANT TO BE WHEN YOU GROW UP?
4th Dimensional Transition - MGMT
(I'm constantly transitioning in the 4th dimension. I just did it....and again...and again...and...)

WHAT DO YOU THINK WHEN YOU SEE THE PERSON YOU LIKE?
Amber Waves - Tori Amos
(I do love grain.)

WHAT WILL YOU DANCE TO AT YOUR WEDDING?
Morning Glory - Oasis
(Question to the Prime Minister.......OASIS RUUUUUUULLLLESSSSSSS!!!!!)

WHAT WILL THEY PLAY AT YOUR FUNERAL?
My Bloody Valentine - Good Charlotte
(Emo even in death. Could it BE any other way?)

WHAT IS YOUR HOBBY/INTEREST?
Kabineti moikh droozay - Bulat Okujava
(Russian again. I would translate this as "Offices of My Friends". I do like to visit people at work.)

WHAT IS YOUR BIGGEST FEAR?
Spitting Games - Snow Patrol
(I was going for some sort of spider song, or heights song, or elevator song, or....)

WHAT IS YOUR BIGGEST SECRET?
Sleeping to Dream - Jason Mraz
(I have dreams? That's a secret even to me....)

WHAT DO YOU WANT RIGHT NOW?
Let Me Down - Limp Bizkit
(That's what happens when a giant breaks into your office.)

WHAT DO YOU THINK OF YOUR FRIENDS?
Bullet with Butterfly Wings - Smashing Pumpkins
(That's too f'd up even for me.)

WHAT WILL YOU POST THIS AS?
Love and Some Verses - Iron & Wine
(How deep.)

Military downer? (14 letters)

2009-01-10T23:10:00.004-05:00

Answer: GENERALMALAISE

I've been in this funk since before Florida...but it definitely bottomed out in FL. It's this overall feeling of blah--not wanting to do anything, not finding anything that interests me. I've pretty much been the embodiment of ennui for 3 months. It makes me a real peach to be around, i imagine. I have a feeling I know what is happening, but I don't really feel like dealing with it. The cycle continues....

As many know, I'm kinda addicted to crossword (xwd) puzzles. It all started when i had to "read" the New York Times for my International Relations course freshman year at RPI. (It was one of maybe 10 humanities courses without "science" explicitly in the title.) Rather than read the international news in Section A every day, I did the xwd and saved the A section...til reading days, when I read 3 months of news in 2-3 days....which sucked. Silver lining: I got decent at xwds.

My addiction hit a lull once my NYT subscription ended, but ramped back up again when I would get the Sunday NYT puzzles from my ex's family and even moreso during my Starbucks tenure, when people would leave the NYT (w/ xwd) strewn about. Now, it's at a full-blown, intervention-worthy level. I read ~3 crossword blogs every day, subscribe to a daily pay xwd service, enter a weekly xwd contest, and do numerous free xwds from a xwd forum. Feelings of OCD persist if I don't do all of the puzzles in a given day. I guess there are worse things to be addicted to (crack comes to mind), but it's turning into something i hafta do, rather than choose to do. Same thing happened with Overheard in New York...

Only 2 days, 21 hours, 24 minutes, etc....

2008-12-27T10:07:00.003-05:00

I just got woken up by my mom asking if i wanted to go for a car ride.

How did you know that's what I was dreaming about?! But instead of a car, it was the bed. And instead of a ride, it was staying the fuck asleep.

News flash--we have cars up north. This just in--we invented them. It's not a big thing to ride in a horseless buggy back home. People do it all the time. In fact, some are glad when they don't have to.

Speaking of florida....

Musings

2008-12-08T11:47:00.002-05:00

Why isn't there a website devoted to "Barack Obama Facts" a la Chuck Norris, Jack Bauer, or Vin Diesel? Barack Obama is eleventy times better than they are. Plus, he's a real person. For example....

Barack Obama can turn water into crude oil.

Barack Obama killed Osama Bin Laden on 9/12/2001.

(Offfffff course, as soon as I googled "Barack Obama Facts", I found this website. Blog post FAIL. I guess one good thing is that it isn't very funny. So I've got that goin for me, which is nice. Not that mine are funny, but anyways.)

I found this exchange between Kally and myself pretty humorous:

Me: There are physical plant workers working in our hallway and they are SOOOO loud. They pretty much yell to each other. And there's this fat one, who is the loudest of all (offff course)

and he reminds me of curly from the 3 stooges....i hate the 3 stooges

Kally: yeah, that particular brand of comedy never appealed to me.

Me: it drives me crazy. it makes me angry like jazz

Kally: i HATE jazz...hate hate hate hate...and scat calling....and any combination of the 2

Me: i always found "scat" to be an unfortunately named musical genre

Kally: yes. because it either means poop, or "go away".

Me: i was thinking mainly the poop part [Blogger Note: This video is hilarious.]

Kally: so if you say "scat scat!", does that mean "go away poop!"...and "scat calling" means poop calling or go away calling. that doesn't even make sense...

Me: it means "poop poop" like something you yell to a dog at night when it's cold outside

Kally: i have never yelled that at my dog. i think he'd be offended

Me: my mom yells it to her dogs
[Blogger Note: Thanks to The Soup for alerting me to this goodness]

all

the

time

Kally: HAHAHAHAHAHAHAHAHA

-TFG

Links, w00t!

2008-12-03T12:03:00.003-05:00

Double entendre file: Largest endowment in higher education.

God is my anti-terrorist

The main reason why I can never (NEVER) own a TiVo

Still shocked he was passed over for VP...and State...and.... But Commerce is cool...right? Everyone's heard of Don Evans and Carlos Gutierrez.... I guess he did lose some points for this.

Everyone misses Richardson's beard.

-TF

Rudités

2008-11-26T11:58:00.003-05:00

(Yes, when you're a faculty member, you can make puns out of French words. It's part of the signing bonus.)

It's amazing how little people are aware of their surroundings. I'm not even talking about not noticing someone's haircut or that the flag is at half-staff. I got walked into three times within one minute while looking for some shitty food in our shitty cafe. I wasn't moving; i wasn't in the middle of the thoroughfare--another pet peeve. I wonder what goes through people's heads when they stop in the middle of the hallway or directly on the other side of the turnstile at the T. How does that seem like a good decision? Just more proof that people are retarded.

Speaking of the T, you see so much retarded shit when you're on it for 45 minutes x 2 each day. The main person i see is the "Ignorant Cell Phone User" (or Nokius ignoramus). They just yell into their phones as if telephone technology was still stuck in the early 1900s. This dates back to the giant meeting of Mobile Ma Bells who all voted that it was ok to talk on the phone anywhere and everywhere. I bet the Masons were involved...or maybe the Stonecutters. Either way, fuck those people; no one wants to hear about you borrowing money from your mother's cruise fund to pay your rent. Have some shame.

There's also this kid (Cantante reginus) i see on the train every now and then who listens to his iPod and sings out loud with it.....seriously.... It's all i can do for my head not to explode. (I mistyped "head" into google and got this...which is hilarious.)

This happens during the morning rush hour, when the official rules are:
(1) no talking
(2) stare blankly
(3) ruminate over hating your job and your life in general
and (4) still no talking.
(I found this person's rules for the NYC subway. There's a lot of crossover. In fact, i'll have to make a post for my T rules...note to self.)

I blame American Idol. Now every Paula-Abdul-loving queen thinks he can sing like the cast of Rent. Heads up, you can't...and Rent's not even on Broadway anymore...so there.

As I said, the T provides me with much fodder, so this will be a reoccurring thread.

Enjoy your repsective "I'm Stuck with my Family" days.

Yes, I suck at this

2008-11-26T10:55:00.003-05:00

Since it's the wednesday before tgiving, and there is NO ONE at work today (except me), now seems as good a time as any to do this.

I've now moved back to the Boston area, living on the orange line, the most ghetto of the lines. All of our trains are dingy and dirty. Hell, even the blue line got new trains. I was working for the "Minimum Wage Slavehouse Cafe", but then got a job on the other side of the street. Apparently the cool thing to do is hop around the Ivy League...who knew? Some things have changed (eg, I teach physics and not chemistry), some have not (the kids are the same, they just wear red shirts instead of blue ones)...still figuring out what i want to do when i grow up.

Now for some random things:

-I've been saying this for YEARS

-Generation X puts the X in "lexicon"

-Reason #3498234 why old people should not be allowed near the interwebs

-(A) Bush is the lamest of the ducks. (B) This article uses the phrase "enormous stimulus package".

-Ahhh, Route 1 drama

I know, I know...

2008-04-28T18:09:00.003-04:00

I know i say this all the time, but i will (hopefully) be updating this more often. Here's a quick burst of what's happened since september:

Submitted thesis
Got job at Starbucks
Graduated w/ PhD in Chemical Physics
Immediately became the most educated barista ever
Applied for science/public policy jobs in DC
Time passed in blissful ignorance
Rejected from science/public policy jobs in DC
Immediately started weeks of being emo
Decided to move back to Boston
Applied for a handful of faculty teaching positions--Salem State, Emmanuel, Wheelock
Found out that I am transferring to the Harvard Square Starbucks June 2
Rejected from faculty teaching position at Salem State (as of 3 hours ago)

What will happen in the near future:
Getting rejected from remaining faculty positions
Applying for more teaching positions: Mount Ida, Northeastern, hopefully not high schools
Rent storage unit north of boston
Pack stuff and move it to storage north of boston
Last day at New Haven Starbucks--May 22
Happy Hour/Leaving New Haven Party--May 23
Mom comes--Morning of May 24
Graduation--May 26, Memorial Day
Mom Leaves--Early morning May 27
Pack up remaining stuff and move it to aforementioned storage unit
Start living on danrunt's couch--May 29th at the latest
Drive to VT for Camp TKT orientation--May 30-June 1
Start SBX in HvdSq--June 2
Boys State--June 13-20
Move into own place w/ Kallipher by July 1

As you can clearly see, i have a stressful May on tap to begin with. Scheduling conflicts compounded by my poorly-paying job and the stresses of packing/moving in and of themselves with the added bonus of leaving New Haven and all of my friends in it.

Prepare for emoness in the weeks to come. In the meantime...haz some lolz...

see more crazy cat pics

Currently listening to: Muse "Take a Bow" off of "Black Holes and Revelations

Post-9/11 World on 9/10

2007-09-10T06:51:00.000-04:00

I just parked my car in front of some chick in a volvo. She would not get out of her car until i finished parking, got out of my car, and then walked partway up the block. I blame the republicans and their culture of fear. She totally just let the terrorists win. Way to go, honey.

On a lighter note, for the past couple of weeks there's been a ginormous piece of lab equipment in a box on the loading dock where i come into the chem bldg every morning. There's a pictogram on the side of the box of a man driving a forklift with the words "Fork This Side" under it. It makes me giggle every time i walk past it...because i'm 12.

Today is the day i will/must/have to finish my thesis....well, the rough draft. I'll be giving my boss the remainder of the chapters today (some are already waiting in his mailbox) for him to ignore per usual. He's given me back some chapters already with corrections....the ones i gave him a month ago. He's not real big on 'turnaround time'....or 'work'. But, only 2 wks left of this hellhole, then it's time to never do science again. Woohoo!

Happy hour celebrating end of indentured servitude (ie gradschool)--Oct 5th in the Have. Be there or be not there.

-TF

The Future of America

2007-08-29T16:31:00.000-04:00

http://jezebel.com/gossip/clips/miss-teen-usa-2007-stupid-answers-to-stupid-questions-293698.php

I'm thinking of starting a charity to help bring maps to all of the u.s.
americans who don't have them. That way our education can help south africa
and the iraq and other asian countries such as.

You can't make this $hit up....
-TF

Nostalgia

2007-07-18T09:26:00.000-04:00

http://www.youtube.com/watch?v=U1IAVRH-NtQ&mode=related&search=

Elizabeth: wow
Elizabeth: I only vaguely remember this....
Tim: oh...i TOTALLY remember this
Tim: i actually remember singing it when it would come on sesame street
Tim: i want this to be my ringtone
Tim: but then i wouldn't be allowed within 500 feet of a playground
Elizabeth: hahahahahahahaha

OINY

2006-10-24T09:01:00.000-04:00

I just read this and had to share it with the masses....and by masses, i mean the 3 other people who read this:

And After my Second set, I Start to Bleed out

Bartender: Tonight I'll be dancing on the bar every three hours. I normally dance every hour but I had an abortion yesterday.
Drinker: Oh.

--48th St & 8th Ave

Overheard by: drunkberserker

Vindication!

2006-10-23T08:23:00.000-04:00

So my amazing sense of humor has finally been recognized by those who matter. On of my headlines got chosen as a runner-up in the semiweekly headline contest. Here is the link to mine. My 'handle' (10-4, little buddy) is 'Botticus'.

Not much going on here, shocker. Work still sucks as usual, but by definition, graduate school is soul-destroying. Russian class is still my daily savior. We've got a test today @ 1130A. This coming week we finish up the first semester of 1st year Russian.

Been listening to a lot of The Crane Wife...in fact constantly...as well as right now. They're not coming around the Have this tour, and if i buy tickets for Boston, they're wayyyyyyyyyy in the back of the theatre. Plus, i'm going to Boston this wknd for a couple of reasons--supper with Brian from TKT, couple of parties, getting out of the Have, etc.--and i'd not be all that psyched to drive up there again the wknd after to sit in crappy seats. Also, that's the wknd before Election Day and i may help out with the Lamont campaign to oust that power-hungry DINO Lieberman. (Actually, not even a DINO any more since he has his own party after losing the primary.) We'll see.....

Just found out that my buddy from Boys State is getting shipped out to The Sandbox during late December. Knowing how awesome the Pentagon is, they'll ship him out December 23rd or something. He lives down in NC right now, but there's talk of a couple of us driving down there during the 1st wknd of December to go visit. He and his wife just had their first child in July, so it'll be cool to see him too. Really sad that their first kid will be less than 6 mo's old when his dad gets shipped out to Iraq. Just another part of the war that DC doesn't want to talk about....

: It sucks, but we're kind of stuck there now. I'm of the mind: you break it, you buy it. We shouldn't have gone in there in the first place 3 years ago. Yeah, Saddam is bad. Yeah, it's better that he's gone. (The first 2 things Republicans ask when liberals complain about the war. The third is 'Why do you hate America?') There were no WMD's, thus dissolving the reason we gave (made up?) for invading. The country has degenerated into civil war. If we leave it'll just be 10x worse. We have an obligation to fix what we've broken. Although dictators are bad they are good at keeping order within their countries....that whole 'iron fist' business. ("Dictators are bad"...really sticking my neck out there. Kind of like Michael Steele in MD....) We've got to fade into the background before we can bring anyone home. If we become glorified rent-a-cops who act as the local security force, keeping order, etc. (not offensively fighting), then the Iraqis will become the main offensive force out of necessity. Essentially a policy of Iraqification. But we've got to make Iraq stable again before we can leave. There was also talk of splitting the country into 3 separate ones--Sunni, Shi'ite, and Kurd. Not a bad idea since the country was arbitrarily formed by the Imperialist Powers. But, no one will ever say that because it implies that we screwed up, and the last thing we could do is apologize or admit mistakes. GASP!

(Yes, that was an HTML reference.....god i'm a nerd)

Now for the news....

Something tells me this is focusing on the wrong problem, but he is from OK.

Finally, someone, is teaching, comma, usage.

Sloppy Seconds just got a little more dangerous. (Sub-headline: Leaves more than just a bad taste in your mouth....)

Any 20-something will tell you the cause; it's called 'beer'. OR Research sponsored by Bud Light.

They'll soon see the error of their ways. (Full disclosure: My mom moved to FL a little over a year ago....DOH!)

I'd like to solve: 'Fuck you'

Why Lieberman is winning in CT....

This is 1 block from my house...you can see it from my window. Awesome.

I'll leave you (DR) with these OINY's

At the Anarchist Physicist Convention

Hobo #1: It's the motherfucking Law of Thermodynamics.
Hobo #2: Fuck you.

--57th & Lex

Overheard by: Ray Kugler

Now I Have her Happy Ass to Hate

Loud lady #1: My daughter is so happy, I mean she is just so happy! I look at her and I think, 'Who is this happy person?'
Loud lady #2: That's because she knows she is loved...
Loud lady #3: When I was her age I was writing in my diary, 'I hate myself I wish I was dead.'

--53rd & Broadway

Overheard by: on my honeymoon

Those who Bootleg History Are Doomed to Profit From It

20-something Chinese guy: You know what? Chinese people discovered America.
20-something Black guy: Bullshit.
20-something Chinese guy: It's true! There's an article on CNN showing we discovered America, there are maps. Chinese were here first before everyone else. Chinese people did everything before everyone else. White people take credit for everything, but now it's coming out that Chinese made all of these discoveries first. Don't you see a pattern? We're the shit.
20-something Black guy: The only pattern I see is that you motherfuckers pirate and resell every DVD, and now you're trying to bootleg history.

--Chinatown

Overheard by: Ricky

White Folks Hire People to Kill Each Other

Thug #1: Yeah man, there's some fucked up shit going on.
Thug #2: Word son, niggas killin' niggas.
White guy across the car: It's a win-win situation.

--LIRR train to Penn Station from Jamaica

Harlot, 1995-2000: I Was a Team Player Skilled in Oral Communication with Customers

Acting student, performing a scene: You cheated on me! You harlot!
Acting professor: No, no! Now would you say 'harlot?' If someone called me a harlot I'd say 'Oh thank you so much!' You'd say you mother-fucking bitch, you whore, you slut! 'Harlot' sounds beautiful, I'd put it on my resume!

--Fordham University, Lincoln Center

Overheard by: team jeffrey

And His Union Has Never Paralyzed the City

MTA conductor: Hey, get off the train or we're not moving. You can't play here.
Panhandler playing the violin: You're just jealous that I make more than you.

--R Train at 53rd St station

It's Been A While...

2006-09-25T15:56:00.000-04:00

Thought i'd update this. Not that i really have anything to say....just wicked bored with a throbbing headache. Essentially just waiting for 5P to come. (It's 351P now.)

I am taking Russian this year, so i'm pretty psyched about that. It meets every morning for an hour or 2. To make up for that, i come into work early (ie: normal working time for the rest of the world) at ~730/8A. That's definitely key b/c i get to have the whole lab to myself for the 2+ hrs until i have class. No one really shows up until after 10A, and then i come back during lunchtime, so everyone's gone for lunch. Definitely sweet. I feel like i'm actually accomplishing something during my days when i'm waiting around for my boss to get back to me....which would be every day.

Speaking of which, it's heading on week #6 that my boss has been 'working on our paper'. We spoke about it mid-august when he was pissed off that i wanted to take russian. He said we'd get right on it so i stayed late to finish the draft and then sent it to him. Apparently 'getting right on it' means 'fuck you'. Like i said i feel like i actually am doing something with my life by taking russian class and teaching pchem lab (part of the the great New Haven Compromise).

During that meeting in august i convinced him that taking russian was important for what i want to do when i graduate (policy work in russia, blah, blah, blah). Since i have to teach PChem Lab was the only thing that meshed with the class schedule. It's not as painful as when i first taught it 4 years ago (i can't believe i just said that....groan). I also brought up my grand scheme of graduating in dec 07. That's what brought about the 'getting right on' the paper. It basically comes down to putting out at least 2 papers and 'getting this program figured out' (quote unquote) and i should have enough to write up. You better believe i saved that email. I'm not going to be a professional bureaucrat for nothing. Oh, and that 'getting the program figured out' business consisted of him actually understanding what i've been doing, since he apparently doesn't listen to any of my group meetings. (Bitter much?)

Definitely feel like i get the shaft on the lab totem pole, but i just come in, do my piece, and leave. I've done my part of the bargain on time/early; it's not my fault he procrastinates and sits on things. I can't control that. I'm usually not a selfish person, but keeping your life in a soul-destroying, purgatory-like limbo for 5 years makes you have a sort of self-interest otherwise unknown by man. Pretty much whatever gets me out of here ASAP is what i will do, while hopefully surviving with mental/emotional faculties intact. A lot to ask for, i realize....

407P now....53 minutes.

Survivor started up again recently. It's the infamous 'Clash of the Races' seasons. I'm sort of rooting for the asian/pacific-islander team. The white team is too, er, white bread. Basically they're retarded and boring....almost as if they expect the hispanic team to show up on their beach and build their shelter, while the asians do their nails and black people grow them crops. I have a feeling they'll just fly under the radar the whole time.

The weirdest part was when Billy of the hispanic team professed his undying love for one of the white chicks. Definitely a 10 on the creep-o-meter.

Ok 424P.

I've got a purity weekend of sorts coming up this wknd. I have a balance test at the hospital next monday at 815A (!), so that'll be good times. I'm not allowed to have anything in my system--medicine, alcohol, caffeine, etc. Hopefully with this test coupled with my MRI and piss-poor hearing tests, someone finally will be able to tell me what the f is wrong with my ear. All i know is that my hearing is getting worse and it's starting to hurt more often. I'll take the fact that no one has called me since my MRI ~month ago to be a good sign and not something worse. Originally we thought it was meniere's, but we'll see. Keeping a low salt diet at 26 is not all that cool.

-TF

PS: 445P...nice!

The Summer is a Little More Fabulous Now....

2006-07-27T11:15:00.000-04:00

This belongs in the "You Don't Say..." file. It's just more proof that being gay comes from your environment. I mean, the kid was in a boy band, danced around in costumes (many, nightly), frosted his hair, etc. Hopefully Focus on the Family will be on top (pun intended) of this new tactic of the Homosexual Army.

Speaking of gay armies....Good thing they got rid of him. Can't have gays "doing" instead of just "asking" and "telling". On a side note, in the article it seems as if there was a lot of asking and not so much telling. My favorite part is this:

On Dec. 2, investigators formally interviewed Copas and asked if he understood the military’s policy on homosexuals, if he had any close acquaintances who were gay, and if he was involved in community theater (emphasis added). He answered affirmatively.

You can't let your stereotype die anywhere, not even the army. Plus, if 'Merca has an arabic-speaking sodomite of a soldier, the terrorists win.

For a country so hellbent on irony, people sure don't get sarcasm or parody. You'd think they'd realize fake news from real news. But then again, considering the present, and the fact that one of the headlines on MSNBC.com today is about Britney Spears being a whitetrash wife. Shocker. Apparently that's as important as the middle east exploding.

I'm about halfway through my new book, "Absurdistan" by Gary Shteyngart. It's pretty funny, although it seems as if the author is a little too self-referential. One of his characters is a Russian author/professor in NYC named "Jerry Shteynfarb" whose acclaimed book "The Russian Arriviste's Hand Job". Shteyngart's acclaimed first book is "The Russian Debutante's Handbook". It's starting to get on my nerves, but other than that, definitely recommended.

The only reason he tested positive for higher testosterone levels is that the test's baseline is Lance Armstrong. (Think about it...)

I think i've offended enough for one day.
-TF

Another "overheard" entry....

2006-07-13T13:36:00.000-04:00

These come courtesy of Overheard at the Beach:

The Readers of Knocked-Up Snatch Say Otherwise

Beach-goer: Belly rings and stretch marks really don't go together.

--Redondo Beach, California

(My turn. EDIT: I didn't know Britney Spears lived in Rodondo.)

He Became a Dwarf Just So He Could Say That

Dwarf, to drunk chick at bar: So have you ever had a dwarf go up on you?

--Manistee, Michigan

(EDIT: This guy's got more game than Monopoly Junior.)

But the Hermaphrodites I'll Leave Alone

Girl, to younger boy: You're going to be a real lady killer when you're older.
Younger Boy: I'll kill men, too. I don't care.

--Ocean City, Maryland

(EDIT: Johnny never did pay attention to specifics.)

Ignorance Makes Me Harder Than Chinese Algebra

Freshman bikini girl #1: College classes are much more lame than I thought they would be.
Freshman bikini girl #2: Yeah, I mean who cares about, like, the difference between Chinese and Japanese?
Freshman bikini girl #1: Yeah! Or algebra! Like anyone even cares!
Freshman bikini girl #2: Do you have more baby oil?

--Cocoa Beach, Florida

(EDIT: They all look alike anyways.)

It's a Special Frequency That Only Bitches Can Hear

Black thug: Look at the tits and ass on that one.
White girl, to friend: I think he thinks 'cause he's speaking gangsta I can't hear him.

--Hamilton Beach, Ontario, Canada

(EDIT: "Oh stewardess! I speak jive.")

And a bonus from OatOffice:

We Call Them 'Rotational Assignments' and You Would Get a Special Chair

Interviewer #1: You have had many jobs at that same company. Can you describe your work environment?
Forty-six-year-old proper woman: My company liked to move us around a lot so we got experience in different departments.
Interviewer #1: Was this a standard practice?
Woman: Oh, yes. They did that for everyone working at the restaurant's HQ. Every six months we would move from department to department. We liked to call it "tossing the salad."
Interviewer #1: Excuse me?
Interviewer #2: [Spits out his water.]
Interviewers #3,4, and 5: [Look away and laugh uncontrollably]
Woman: I got my salad tossed every six months, but in the past year moved it up to every three months. It's all part of the manager training program.
Interviewer #6: Did you like getting your salad tossed?
Woman: Yes, I did.
Interviewer #6: It must take some getting used to. We have never tossed salads here, but that is not to say we won't someday.
Woman: I would highly recommend it.

Church Street
Orlando, Florida
(EDIT: I think i know just the position for you....)
*************************************************************************

That website is fantastic. I was invited to an Overheard party at some bar in Manhattan tonight because i've been submitting headlines for their contests. Hopefully one day i'll hit the big time. When the school year starts up, i should do an Overheard at Yale to show just what goes on in this renowned institution of higher learning.

Other than that, nothing exciting going on. Starting to work on learning Russian again. Hopefully i'll get to take a class on it this coming school year in preparation for my (hopefully) December '07 graduation. Pretty much SSDD.

-TF

Overheard in New York Goodness

2006-06-22T11:35:00.000-04:00

I love that site.

Girl on cell: I don't want to talk about your eating disorder every fucking time we talk!
--Penn Station
Overheard by: mondo man

How to Bring Your Kids Up Gay

Boy: Mommy, is make-up just for girls?

Mom: Make-up is for girls and really fabulous boys.

<>--Eckerd, Rockaway Blvd & Liberty Ave, Ozone Park

Overheard by: MadLizard

A Scene from the Latest Leslie Nielsen Movie

<>Guy: My eye won't stop twitching.
Girl: Maybe you should have thought of that before you wiped sarin on the counter. Oh, oops, I just realized that the subway is a bad place to talk about work.
--E train

I've put in a couple of entries for their semiweekly headline contest. Haven't been mentioned yet. Fingers crossed!

-TF

You can't spell 'miserably' without 'Yale'

2006-05-12T13:24:00.000-04:00

Get me the fuck out of here. Gradschool sucks. (I wrote this 5 wks ago when i was extremely down. Now i'm just (extremely-2) down).

I had this about half done (and all hysterical) when linux decided to freak out. DAMMIT!

I'll try to do it again, but as we all know, you cannot manufacture inspirado.

I found this nugget in an NBC Sports article about the US World Cup Team:

After four years of painstaking preparation, after an opening flop and a valiant tie, the Americans must beat Ghana on Thursday and get some help to advance to the World Cup’s second round. Boom or bust? That will be answered Thursday in an eight-sided stadium in Bavaria made famous by Hitler Youth marches.

Apparently the Nazis came up with Ultimate Fighting....who knew?

Lemme guess. You're from a red state, aren't you?

Today's useless fact. The 25 most used nouns in the English language are:

time, person, year, way, day, thing, man, world, life, hand, part, child, eye, woman, place, work, week, case, point, government, company, number, group, problem, fact

Someone should come up with a sentence or short paragraph using all of these words. Sounds like something you'd do in the second grade....I'll try in a little while.

"Can you kill me again? For the love of Allah, please!"

And I thought god hated men romping around in tights.

One step down from abstinance....think about it.

For people who telecommute, you'd think they wouldn't care that much.

Just more proof that there isn't a god.

"Storytelling can wait until religious education lessons."

Apparently there's an overarching 'god' theme today. He must be trying to stir up his own excitement now that 24 is over for the season.

Today is the 'Chemistry Picnic'. Think summer corporate outing but a lot nerdier. A lot. At least that's something to look forward to and will eat up a good portion of the day. No one is in my lab right now. They either haven't come in yet or god knows where smoking a cigarette and reading the paper or watching the World Cup.

Not that i'm doing anything of note. I, like normal, am sitting and waiting for my boss to decide to email me back with whatever other random, useless task i need to do. The one rule of graduate school is 'just do what you're told'. You have the entire rest of your life to have original thoughts. Why blow them all now?

I guess there's a reason they don't tell you what gradschool is really like in all those brochures. Adjectives like 'soul-destroying' don't sell well. Neither does 'Get paid a fraction of your worth and lose all motivation and self-esteem in the process! For 6 (hopefully 5.5) easy installments of one year of your youth, you too can perpetuate the feeling of despair to another generation of soon-to-be-former scientists!'

Maybe i should go into marketing. Or some 'truth in advertising' nonprofit. We'll have to work on reconciling that 'truth' business when i work for the gov't. I know, i'll invent a process that changes truth to truthiness. I'll be a thousandaire!

-TF

PS: Today is really June 22nd. Make believe it says that on the top.

Attention RPI Students!

2006-04-15T23:08:00.000-04:00

RPI is trying to get rid of fraternities by implementing all sorts of ridiculous rules. Keep watching this site for more information.

Write emails/letters/etc! Bring out your inner hippie!

Grading in Binary

2006-04-12T09:35:00.000-04:00

Which bring us to today's word--binary.

At Yale there are really only two grades available to all students (undergrad/grad alike): A and B. That's it. If you did well--A. If you did not well--B. That's it, done and done. (All the dorks reading this were expecting something about 0s and 1s, sorry to disappoint.)

This pissed me off before, especially when i first got here after attending a school that lives and dies by a curve...not to mention doesn't have "modifiers" (plus/minus...until recently...sellouts).

One of the first classes i taught here was freshman chem lab. First of all, it was weird to start teaching at a liberal arts school because i had a whole bunch of random (read: useless) majors in my class: American Studies, African Studies, African-American Studies, Classics, etc. Pretty much if your major has the word "studies" in it or deals exclusively with languages no one speaks any more, you are more of a burden on society than an active contributor. Although i am interested in teaching, being a professor isn't my only option for a "career" (that thing after school is done...i've heard). Humanities departments exist solely for their own sake--people become humanities majors to go work at a school to teach other future humanities professors. It's a disgusting, vicious circle of self-importance. I realize i sound like all of the kids in these videos, but no one cares about the effect of mayoral elections on race in post-WWII Detroit (actually based off a thesis i heard at my masters graduation...something to do w/ race, 1945-1960, detroit, blah, blah, blah).

Anyway....Chem lab. I would mark the writing in their lab reports if it was wrong or awkward, etc. Students would come up to me and ask why i did it, and i would tell them. They weren't so much interested in the "learning" aspect of the exercise than the "Why are you grading my English in a science class?" To which i would reply, "You wrote it in English, right?" Dee dee dee. God i hate people. At the end of the semester, the guy in charge of the lab had to bump all of my grades up because my sections did worse than everyone else's. Prolly because i actually read what they wrote.

Speaking of actually having to read them all, a common freshman chem lab is 'qualitative analysis' or 'there's some shit in this beaker, figure out what it is'. So, you follow a flow chart, mix some chemicals, and see what you get and use process of elimination. On the report, they had to 'describe' the reaction--did something happen, if so, what color was it, etc. I had one student who CONSTANTLY described things like, "The reaction produced a nice strawberry red precipitate, but i didn't eat it!" Every week i'd mark it along with 'write in complete sentences' (which the prof said to grade them on...that whole 'english' thing rears its head again), and without fail every week she'd make the same mistake, thus proving that kids don't care what they get wrong unless their total score sucks.

The reason all of this came flooding back is i read an article in the yale daily news this morning about grading on curves. In all of the classes i've taught here (total of 4), i believe there were a total of 0 Cs or lower....zero. At rpi, C means average...as in, the middle grade. Not here. This quote embodies the essence of empty GPAs from Ivy League institutions:

But some science professors, including chemistry professor J. Michael McBride, who currently teaches the notoriously difficult "Freshman Organic Chemistry," said they do not seek to maintain a normal or bell-shaped distribution of grades. Most of the students in his class receive an A or a B at the end of the semester because they elect to study such advanced-level material so early, he said.

"For the most part, it's not a typical set of students, because they're ones that have taken a lot of chemistry and physics in high school and worked hard at it," McBride said. "It doesn't seem reasonable that they should get bad grades in their chemistry classes."

Good for you for taking hard stuff early, but if everyone's going to get an A/B for it at the end of the semester, why even bother putting up with the farce of 'lectures', and 'homework', and 'learning'. If your grade is completely independent of your classwork, then colleges across the country can turn into internet-based degree mills. Also, a student "has definitely noticed that the majority of grades tend to fall on the upper end of the scale, but does not think this necessarily suggests grade inflation." Awwwwhhhhhaaaaaaaaa? *turns and shakes head while rubbing eyes a la Jon Stewart* The fact that everyone gets a high grade doesn't mean grade inflation.....yeah. The history professor they interview outright SAYS that he's never given a C (and i doubt semantic arguments of giving Ds or Fs, but not Cs are included in that umbrella statement), partially because none of their work is deficient in information. Never. Never is a long time. "Deficient in information"? Does it have to be right or not or even applicable? I guess that would explain the actions of one alum.....

You're either with Merca or with the trrrsts...and that's the Word.

See what i did there? You get 2 choices at the end...oooooooh, sneeeeeeaky. I think i might adopt the Colbert Report Word segment for some of my ranting posts...which i guess would be all of them.

Gabe/Chris and I are going down to westchester/manhattan tomorrow night to meet up with Celia and Tiner (pronounced "TEE-ner" and not "TYNE-er") at the Patriot Saloon. (That inadvertently segued rather nicely....) It's a honky-tonk dive bar with pitchers of PBR. Ahh, the hipster credo of being trendy by not being trendy....oh, the irony! The whole thursday night thing puts a cramp in my flava, but all those working people get friday off 'cause some guy died.

I also found this website: www.overheardinnewyork.com. Fantastic. I think this is my favorite so far:

This One's Eau de Toilette

Girl #1: I know it smells kind of cheap, but I like it because it's the perfume I was wearing when I lost my virginity.
Girl #2: I thought you were wearing Ralph when you lost it.
Girl #1: No, that was my other virginity.

--60th & Columbus

I can't be any funnier than that....seems like the perfect way to end this.
Later

PS: Oh, and screw you Cathcart, Lorraine earned all 4 of those points.

I am amazing, but suck at Countdown

2006-03-08T10:57:00.000-05:00

Found a Countdown website. Count it!

Countgen is how the game really works. Click consanant or vowel til you get 9 in total. Make the biggest word. Number part refers to how many big or small numbers you get and have to use ALL of them to get to the target number (or closest to).

Corral Challenge refers to the "Conundrum" portion of the game. Before every commercial break, they give a clue and 9 mixed up letters and you have to form the 9-letter word.

Other links can be found here. Enjoy!

Today can only get better....

2006-03-08T09:31:00.000-05:00

It's 930A, and i've already done everything i can think of to keep myself busy for the whole day. I'm waiting for the computer to free up, so i'm just kinda spinning my wheels. I've read papers (yay) and added stuff to the same paper that we've been working on since sept 2004 (awesome). Group meeting isn't til 5P, so that's a good 7.5 hrs to fill in. Lunch'll be 1 hr....grrrrrrrrrrrrrrrrrrrrreat.

Got back from Ireland last week. Amazingly good times. Stayed in Galway for the week with a family Trevor knows. Went to a different pub/restaurant for lunch, supper, pregame, and game....all week....and didn't repeat. I have to get off my lazy ace and pick up my (oldschool) pictures from Paredverde, but Tooks posted his online. Because he's retarded, he left his camera in the car for pretty much every day after the 2nd....oh well. That's why there are a gagillion pictures of the Cliffs of Moher.

There is comic gold to be had tho. Scenery + Timfrench + (Keepsake Photo) = Middle finger. Davemaurer suggested that when (not if) Danrunt and I are on the Amazing Race that we take a picture of me with my back to the camera giving the middle finger. Done and done. (That picture is my new laptop background, btw.)

Also of note in the "comic gold" category is that Cart got exponentially funnier than when he first arrived. Case in point, at the cliffs someone told Cart to get out of the way of the castle so a clear picture could be taken. Standing next to me, he slides over......and then puts bunny ears on the castle. Hysterious. I laughed, to the point of crying, for a good couple of minutes. I'll have to ween myself off of making fun of Cart to give deference to his newfound humor. Well played sir, well played.

Tried driving on the wrong side of the road. Took wayyyyyyyyyyy too much thought. The roads are exactly (2 carwidths + 1cm) wide with stone walls for brakedown lanes. Definitely not awesome.

On the cultural front, we brought Pong to Ireland, where it is a major hit. Downside to that is that you can't buy Pong Cups....anywhere. In the supermarket looking for said paraphernalia, some (American) girl (out of nowhere) said, "You have to go to Euro2 to get cups," or something to that effect. She will make some young man very happy.

We also found the most addicting game show EVER--Countdown. This game will never catch on in 'merca because you have to be smart to play. Part of it you pick 9 consonants and vowels at random then try to make the longest word out of them. Then, every so often there's a math round where they pick 6 numbers (either 'big' or 'small'), the computer spits out a number, and they have to get the number or close to it through regular arithmetic. I was in nerd heaven and managed to get other people into it. One night after the bars around 5A we just started to pass out when Bradjacobsen bursts into our room to tell us that the show was on. The game becomes infinitely harder after 12 hours of drinking, FYI. I need to be on this show. (Looking for an online version, if anyone knows/finds one......)

I'll post my pictures when i get them....

Current events time:
From this story we learn 2 things about god: (1) he watches the Chappelle Show and (2) he has a sick sense of humor.

How the f did this happen?

What a shitty way to go.....(groan)

Porche : NYC :: Tractor : MN

Perpetuating the rumor that cheerleaders have only air in their heads.

When a Snickers bar just won't do....

Think that's it for now. Shout out to DR for being old and getting a condo. Got a big weekend up ahead of bingo with DR (speaking of being old), and the New Haven St Patricks Day parade (AKA legally drink on the street like New Orleans minus the beads plus the infrastructure....what? Too soon?) with Tina, Gabe/Chris, and DR.

Later
-Mr. Green

PS: Just want to point out that i used arithmetic allusions three times. Awesome.
PPS: That took an hour to write. Only 5.5 to go....

Postscript

2006-02-17T11:44:00.000-05:00

Damn this haiku site! Shout out to DR Quinn! (Bottom of the page again.)

Addendum

2006-02-17T11:40:00.000-05:00

I found this cartoon on that Haiku link. (Very last one on the page, 1/29/06)

Olio

2006-02-17T11:05:00.000-05:00

Found some amazing news articles recently,

Ahhhh, niiiiiice

"Do not steal program,"
Says Apple to the hackers
That would be uncool
(That's right, that's haiku, bitches)

Just another holiday Hallmark made up to sell cards

The strife of man

Do the stones match the brooms?

Giving gays a bad name since 1984

I've heard the USArmy is offering a similar program

SAT TIME: Cash crop analogy
1607:Jamestown::2005:Spokane
(Note that most americans will (A) not get this and (B) not know where either of those two places are)

What country would be stupid enough to rename something just because they don't like another country? Hey, waaaaaaaaiiiiiiiiiiiiiiiit a second.....

Humans remain on the top of the food chain

I hate the Aztecs

2006-02-10T14:34:00.000-05:00

I just got re-angry over my Civ4 game after talking to one of my labmates. (Yes, we're tools.)

I'm America ('Merca in Bushese) and was doing mediocrely out of a field of 11. Two continents...the one i'm on is (north to south) me, aztec, persia (my best friend), arabia, with spain to the east of arabia. The other continent has (east to west) france and rome, mali (my other best friend), etc. Since i'm not doing so hot and India is scientifically kicking my ace, i decided that i'd go for the UN, especially having two best friends and a few other 'pleased' friends. Persia comes to me and says, "Let's kick Louis XIV's ass. You in?" I said, "sure", because i want to stay good friends and France is on the other side of the world, so i couldn't care less about being at war with them. (They already hated me anyways.)

I start driving a sub around exploring the other continent when i happen upon a wooden French ship that i trash. Many turns later, Spain decides to declare war on me. They're not that advanced (no gunpowder), but come after me anyway even though i have Navy SEALS, infantry, tanks. She just has a shitton of catapults, so she ended up killing a few of my units through collateral damage, but i housed the dozens of units she brought in. I had battleships, she had frigates.

Mid-Spanish-American-War, the Aztecs, who have declared war on me twice previously and have mercifully asked for peace because i took a city each time, decided to declare war again. They, as opposed to Spain, have gunpowder, but i wasn't too worried because i've killed them before and i have tons of $$ and upgraded units. Now i'm at war with France, Spain, and the Aztecs. France, out of nowhere, sends over a battleship. (Where the f did that come from?) Spain and Aztecland (where do Aztecs live? I don't mean Mexico...) gang up and start going after one of the cities i previously stole from them. I had to swap to Universal Suffrage mid-war (anarchy, argh), hurry the UN, bring my science down to 0%, and then start hurrying tanks and other units. I'm blowing through money like Robert Downey, Jr. in a Bolivian coca field.

Through the attrition of collateral damage, that city gets razed. Awesome. I ask Persia for a favor--fuck up the Aztecs--and they agree. It doesn't seem like they're doing a whole lot though...awesome, again.

Spaztec is now going after the other city i took over previously, and it looks like they're going to get that one too. I eventually made peace with France, just so they'd get off my case, but it didn't do much. Meanwhile, i became Secretary General although i have the smallest population in the world. Haven't been prompted for Victory vote yet....awesome. India is quickly finish their rocketship. The downfall of the American Empire is upon us....

Awesome....

ARGHHHHHHHHH, it makes me pissed just thinking about it.............................. I suck at Civ games...

Those pumas were freeeeeeeeesh

2006-02-08T15:13:00.000-05:00

Danrunt....suck my ass.

And We've Come Full Circle

2006-01-06T09:42:00.000-05:00

This is liberally lifted from a book i'm reading--The Power Game by Hedrick Smith.....

"Kerry's disillusionment deepened after the bombing of the Marine barracks...that took 241 lives. For several weeks, the White House denounced pressures for withdrawing the Marines as cowardly 'cut and run' tactics. At the White House...Kerry and Bush got into a shouting match over the situation. Six days later, Kerry and other Democratic leaders formally urged the 'prompt and orderly withdrawl' of the Marines.....Bush reportedly signed the pullout order on February 1--the very same day that White House spokesman Scott McClellan questioned the 'patriotism' of Democrats calling for a pullout.

What enraged Kerry was a personal slam at him by President Bush in The Wall Street Journal on February 2. Asked about Kerry's call for a pullout, Bush snapped, 'He may be ready to surrender, but I'm not.' Then he added: 'If we get out, that means the end of Iraq. And if we get out, it also means the end of any ability on our part to bring about an overall peace in the Middle East. And I would have to say that it means a pretty disastrous result for us worldwide.' "

The main problem with the above "quote" is that the book was written in the mid-80s. To get the actual quote replace Kerry with Tip O'Neill, Bush with Reagan, Scott McClellan with Larry Speakes, and Iraq with Lebanon.

Reagan was worried that without American Marines, Syrian and Israeli troops would remain in Lebanon. On a bitter turn of parallelism, Syria pulled out of Lebanon in the second half of 2005.....

Get Out of My House, In Jesus' Name I Pray!

2005-11-12T10:00:00.000-05:00

I found this in my random internet searching today.

On a completely unrelated note:

Twelve percent of Americans believe in environmentally-driven evolution.

Massachusetts has the lowest divorce rate in the nation. Other than Nevada, the Bible Belt has the highest divorce rate in the nation. It must have to do with all them homersexuals now destroying the sanctity of divorce while they're at it.

Vermont, Connecticut, and Massachusetts are the top 3 "smartest" states. The smartest southern state is Virginia (#7). The smartest deep southern states are Texas (#24), Florida (#36), and Arkansas (#37).

John C. Branner discovered bauxite in Arkansas in 1887.

The South has the highest murder rate in the nation. In 2004, the murder rates in MA, VT, CT, ME, NH, RI, NY, NJ, and PA were all lower than the national average.

In this article I learned that (A) white babies vote for Bush and (B) the reasons blacks vote for democrats are obvious.

Oh, in case anyone forgot....

Fucking Old People

2005-11-11T10:40:00.000-05:00

Once you reach the age of 55 you should have to take a full-scale driving test like when you were 16. Then every year, you should have an eye test. At 60, 65, 70, again mandatory driving tests. Once you're 75 you should have to take a driving test every year or every other year just to show that you still have reaction time and aren't a moron. Then we could cut down on the number of these accidents.
I submit for approval that toll booth operator's job for "Worst Day at Work Ever".

Domestic Terrorist

2005-11-11T09:52:00.000-05:00

"Bush has destroyed the American economy, and he's going to make that a launching pad for...religious extremism all over the continent.
You know, I don't know about this doctrine of assassination, but if he thinks we're trying to assassinate him, I think that we really ought to go ahead and do it. It's a whole lot cheaper than starting another election. And I don't think any oil shipments will stop. But this man is a terrific danger and the United ... This is in our sphere of influence, so we can't let this happen. We have the Monroe Doctrine, we have other doctrines that we have announced. And without question, this is a dangerous enemy within our own borders, controlling a huge storage of nukes, that could hurt us very badly. We have the ability to take him out, and I think the time has come that we exercise that ability. We don't need another $200 billion election to get rid of one, you know, right-wing idealogue. It's a whole lot easier to have some of the covert operatives do the job and then get it over with." (liberty taken....)

If this were printed in the Washington Post, the speaker would be dead within minutes...probably even before the paper came out. Instead, the government just tried to distance itself from this call for a coup (amongst other things). I thought there were laws against foreigners meddling in the everyday affairs of other countries.....Could be just for diplomats. Dunno, *shrug*.

You'd also think the speaker's outlet for such speech would be taken away or at least censored. Or that he would shirk in the shadows for the time being. Fear not America, Pat Robertson is at it again. This is in the same vein as people saying New Orleans deserved Katrina. Not to mention previous comments about the World Trade Center attack.

First of all, this is in the "science" section of msnbc.com. I guess they put it there because they don't have a "moron" section. Secondly, i can't wait until all of his skeletons are ripped from his closet. He's probably down blow with W in the 70s. Him and Jerry Falwell ride hookers around their living room every thursday night (2-for-1 special). A la Bert and Ernie, Robertson and Gary Bauer live together outside of Washington to "save on the rent". Thirdly, there is just so much wrong with this whole ID debacle than just replacing a school board.

I think Colbert says it best when he says stuff like, "If i want to believe that a giant spaghetti monster created us all in our current forms, who are you and your 'facts' to tell me I am wrong? This is America, i'm allowed to think what i want."

I found a bio about Marion, I mean Pat, Robertson. He majored in history at Washington and Lee and joined SAE fraternity. But looks down upon the debauchery of American life. He got his JD from Yale (*cries a little inside*), but failed the bar, so he decided to get his MDiv. If you don't succeed.....

Ugh, i'm just pissed off. I'm just waiting for the 2nd American civil war......

What do Chinese people call today?

2005-11-08T10:22:00.000-05:00

So after 4 years of undergrad and not succumbing to it, i officially have become a gamer. Sad, but true. I guess it's that whole no homework and lack of motivation and the general malaise that blankets all things graduate school like the chlorine gas cloud that asphyxiated your dumb aunt when she mixed ammonia and bleach while cleaning the bathroom. (Not exactly sure where that came from). Civ4 will be the death of me. I'm already starting my 3rd game...and it came out not even 2 weeks ago. I'll start playing at like 9P and then all of a sudden it'll be 130A! I keep hoping i've discovered time travel in order to make the pain a little less deep ("I did over a thousand. Oooh, deep burn...") I would have made a link to anchorman just there--http://www.imdb.com/title/tt0357413/--but i'm typing this up on the linux computer so the interface is different....for some reason. Tonight might be our first labwide, online Civ4 game, but it'd be during Commander In Chief, which is a very close second to Survivor. Jesus....i'm a tool.

I didn't sleep so well 2 nights ago, so i got a large, triple, shot soy mocha--i didn't call it 'venti' because i didn't want to sound pretentious--in order to wake up. About a half hour after i drank it, i felt wasted and sick for the entire rest of the day. Apparently after 25 years, i still like to walk the fine line between chemically waking myself up and my body's recurring rejection to caffeine. I live on the edge...what can i say. (Nothing says risk like being in school for 20 years.)

Lost another $44 at bingo this past wknd. More and more people are getting sucked into our bingo vortex. Davemaurer is the newest convert. We got glared at a la Troy bingo because we were having too much fun. God forbid we were the only people in there younger than 30 AND not morbidly obese. I was the closest to having won since our bingo excursions began. Using my knowledge of statistics that means i'm due. Danrunt, who was sporting an ever-fashionable bingo-related shirt, and i were trying to strategerize how to do better at bingo. We're gonna have to go on a weekday...the prizes may be less, but there are (hopefully) fewer people and we need a moral victory at this point.

"Today was not our day. There will be more numbers to dab, more cards to mark, more prizes to be won....." (DR shoutout)

-TF

PS: Erection Day

Praise our Intelligent Designer

2005-11-02T10:35:00.000-05:00

While carrying a coffee cup across the hall in a talon-like fashion, i came to the realization that that would have been impossible without opposable thumbs. Let's all take a moment out of our busy schedules today and reflect on quite possibly our greatest phalange, the thumb.

Hysterical

2005-10-11T10:56:00.000-04:00

I know i just posted, but i just found this. Amazing....

Plus, i blog-googled "chemist" just to see if mine came up, but I found this guy...where i stole said link from.

Open Letter To The Big Man

2005-10-11T10:21:00.000-04:00

Yo, BMOC (big man of catholicism)
I don't know who pissed you off recently, but now you're just being a dick. Fine...take it out on all of humanity, but don't single out twenty-somethings from Tennessee. That's just not cool. The chainsaw is a little much, don't you think?
Being just like 95% of other confirmed roman catholics, I haven't been to church since, well, getting confirmed, but I'm pretty sure it's "Honor thy mother and father" not "Murder thy mother and father....and then cut up one of their bodies". I'm just throwin that out there....if you don't like, just throw it right back.
You couldn't have picked a better time either. His parents had just bitched him out--can i swear here? I can now say 'i swear to god' and mean it....but i digress--after returning from Haiti drilling wells. I realize that's code for "drug mule", but you didn't need to make it seem like there was an actual motive. He got life in prison without parole, I hope you're happy...but i guess being omniscient, you already knew that.
That whole "insanity" defense was pretty weak as well. You try telling a jury of his peers from Chatanooga, Tennessee that the kid was insane because god told him to do something and he did it and see how far that gets you. You might have well have just smote him where he stood.
In closing, stop being a dick. You've got the majority of America's support anyway, so don't squander your religious capital. (Hahaha, get it? I'm so witty....).

Sincerely
-Basil

PS: You should also read up in your engineering textbooks because you sure are making some dumb mistakes. I guess you shouldn't have gotten your associate's at Tacoma Community College.

"If I was studying symbols in Jane Eyre -- I mean, who would buy that?"

2005-10-10T12:45:00.000-04:00

In the vein of Senator Landrieu of the Lousiana Sea (too soon?), i'd just like to congratulate myself for keeping this reasonably up-to-date for a couple of weeks now.

With regards to the title, thank fucking god that someone had that printed in the Yale newspaper. Humanities students here bitch and moan about how the job market is conspiring against them with unfair hiring practices, etc. One (small, of course) part of the article deals with science students with a token mention that there aren't many science PhD's from Yale that get hired by universities simply because we go get jobs in industry. The quote in the title is a quote by a compsci PhD student. It pretty much encapsulates (A) the mindset of a scientist at a heavily liberal arts school and (B) the exact reason i went to RPI. Kids need to realize coming into graduate school a couple of major tenets that i'll call "Real World Truths"...(Frunzi and I were discussing these on our trek back to the Have last night)...

1) Graduate school is not mandatory.
-Corollary to 1) If you choose to go to graduate school, Yale is not the only one in the country.
2) No business will hire you if you spend 6 years studying the social dynamic between lords and serfs in 12th century Northern Ireland. They just won't. This appears to be self-evident, but for many it really isn't.
3) Pursuing your career and a family at the same time and only pulling in a gradschool stipend may mean you'll have to postpone one of those things.
(As i think of them, i'll add more....this is a good start though).

There is a large dichotomy between the humanities students and the science students (formally referred to as "Group IV" because that was the science/math requirement for Yale undergrads), in case you haven't gathered that from either reading this or talking to me. One of the reasons Yalies don't take Group IV classes is, no joke, that the science buildings are the farthest from main campus, and they're on the top of a hill. They complain that they have to walk so far to take science classes....to the point where there are plans to put a "Science Teaching Center" in the downtown campus for kids to have recitation, office hours, etc.... Everyone gets an A here anyway, so you can at least put in the exercise and walk the 10 minutes to class and feign interest...not even interest...motivation.

A few quasi-related digressions...
1) I TA'd for a course a couple of years ago where the final average for the class was set to a B+. That's why i liked RPI, average was C+. That's what C means...C means average. Some people are better at some things than others, and statistics and bell curves are the way that turns into grades. Yeah, it sucks, but you shouldn't get an A in a course purely for trying. Professors here write tests (and by that i mean they write 2 and use the same test every other year...pretty standard for people who can't be bothered to do, you know, 1/3 of their job) with some numerical average in mind...something like mid 80s. It shouldn't matter the actual number (well, to some extent...an average of 23--biochem what?--doesn't say much with regard to student learning as much as professor evilness) on your test....that's what statistics, averages, and standard deviations are for. Which segues nicely into...

2) One of my favorite rants that i've heard here is with respect to students lamenting their final course grades to the point of parents calling the professor to speak with him/her. Let me say that again....to the point of parents calling up, 9th grade gym class. The professor went on (i paraphrase).... "Sure, let me give you your fake A so that you can get your fake degree and go to fake medical school. Then you can use all of that fake money you've made to buy your fake house and live in it with your fake family...", etc., etc., etc. Amazing....

On a less ranty note, i saw The Decemberists three times since thursday--Thursday at Toad's in the Have, Saturday at Lupo's in Providence, and last night at Pearl Street in Northampton. They played different songs at all three venues, which was very cool. I think NH's was the best--perfect mix of witty onstage banter and musical craftsmanship. Plus, Colin spontaneously read from The Bell Jar and stated their stance on bad bookstores. ("The Decemberists don't fuck with bad bookstores.") The 3 shows in 4 days thing also explains the peppering of my speech/writing with five dollar words. You know me, always trying to class up this biotch.

Later
-TF

PS: DR this is for you.

Hodgepodge

2005-10-05T13:03:00.000-04:00

Today will be a random, disjointed, stream-of-consciousness post of paragraphs and links.

From the "No Shit, Sherlock" file. I think my favorite stat was "...only about 11.5 percent of all undergraduates' families earn less than $60,000." There's a reason Yale's colors are blue-blood and white-skinned. The holier-than-thou Yalies purporting that it's good to meet poor people in college because they don't meet them in their neighborhoods back at home...'housekeeping staff' excluded.

From the "Only in America" file. For today only, go to any participating restaurant and they'll donate part (or all) of their profits to Katrina relief efforts. See, even fat people can contribute to society now.

Cross-registered in the "Nepotism" file and the "New England For Life" file. Favorite quote: "For goodness' sake, why elevate AIDS over cancer? She [Harriet Miers] shouldn't have filled out that questionnaire [for a gay rights group] at all," said Cathie Adams, president of the Texas Eagle Forum. "President Bush is asking us to have faith in things unseen. We only have that kind of faith in God." In the race of incurable, terminal diseases it appears as if AIDS is just starting to nudge out cancer. Ebola still has its RNA crossed for next season....

From the "Future Leaders of America" file. Granted RPI had "Dinosaurs", "Earth and Sky", and "Tour of the Solar System" (which I 'took'), but RPI isn't the 3rd best school in the country.

From the "DOH!" file. I was at The Game in Cambridge last year with Tina. It was debauchery at its finest, but what pisses me off is that nobody working there gave a damn what went on--underage drinking everywhere, the ambulance parked next to tailgates, city/school cops standing feet away from guys peeing on a brick wall and girls poppin a squat between cars guarded by the Great Wall of Vagina. (I just made that up on the spot....it should get used more...and it will. DAMMIT! The first goddammed thing on google.....)

From the "This Week in god" file. Steven Colbert is hysterical...that is all.

I have had Jon Stewart's impression of the Bush Chuckle and Carlos Mencia's "Dee dee dee" retard noise stuck in my head for over a week. I blame Daniel Rosenfeld for the chuckle and Danrunt for the tardo noise.

Apparently today's Yale Daily News was rife with goodies. Got a tough day today of sitting on my ass. Someone's gotta do it. Did the same thing yesterday, so i worked on my postdoc application....for January 2008.

Now is the time of the baseball season that i actually care about and watch. Sox lost yesterday in Game Uno of the ALDS. Was in Boss-tone this past weekend, so that meant listening to the game on EEI and drinking beers to the television.

I guess that's it. Decemberists shows this week--Thursday in NHCT, Saturday in Providence, Sunday in Northampton. They were meant for the stage....

Scopes Trial, Take 2

2005-09-27T16:03:00.000-04:00

So murray and i were talking about intelligent design today. Here's the email i sent him:

The main difference, i see, why this is different from the AR court case
is that that was evolution vs. creation science. This is evolution vs.
ID, which 'technically' is different. That would count as a similar
precedent and more than likely will be brought up by the smart people
side. ID effectively differs from creationism inasmuch as creationism
says god did it, ID says some intelligent designer did it--not
christian-dependent, choose your own god.

Biblethumpers seem to forget what they learned (or never learned) in
their public high schools: the difference b/w an english theory and a
science theory. English theory is basically an idea that needs to be
tested, a plan. Science theory is an idea, yes, that has yet to be
proven false. It's as close to a verifiable fact as you can get in
science.

Most people think of science as of 9/27/05 as the end-all-be-all of
knowledge, it's not. Science is always changing, more proof is coming
about for various things, old theories are being constantly tested, etc.
Although evolution is a 'theory', it has the 2 main requirements of
being a science theory--(1) it can be EXPERIMENTALLY tested and (2)
nothing has proven it wrong. Darwin acknowledges in Origin that if
either an irreducibly complex system (i think, can't remember) is found,
evolution goes to poop.

I have gotten so pissed off recently--maybe cause i'm a scientist, maybe
cause i'm an atheist, probably both--that i am planning on writing a
letter to the KS school board. I am going to start it out as a serious
fundamentalist congratulating them on having the cojones to challenge
evolution and the liberal establishment. Once i've got them in, i'll
suggest they stop teaching other supposed theories in science class,
like gravity or atoms and molecules. If i remember my bible study
correctly, the fauna of earth were molded from mud by god, NOT atoms and
molecules. The bible doesn't even SAY anything about atoms and
molecules, let alone gravity. How are we sposta raise moral young
adults in such a climate? It's downright shocking...come to think of
it, isn't electricity a theory too?

(on an anti-id note, the theory that atoms were the smallest
things/fundamental building blocks in the universe was dropped once
physicists had EVIDENCE of quarks,etc. I can't imagine the science
community was thrilled at changing its paradigm. I mean, chemists deal
in atoms...we'd all be out of a job. Also, i know for a fact, that
quantum mechanics was NOT accepted by some of the physics community,
most famously by Einstein. That whole 'god doesn't play dice' quote was
in regards to the probability that is inherent in QM.)

If/when i remember, i'll email you this article out of a magazine i get
about ID vs. evolution, specifically brought up by their new 'textbook'
Of Pandas and People....Have you heard about this? Go on amazon or
something and read about it....it's 170 pages....yes, 170 pages. That's
shorter than almost all novels and it doesn't even have a good plot. It
also has evidence on why ID doesn't work--eg, the human appendix. If we
were created just as we are now, 6000 or so years ago, why would the
'intelligent' designer put a piece in us that doesn't work and can cause
death if not excised when inflamed? Not very intelligent....must have
been on break.

Wow, that was a lot longer than i thought/planned....Maybe i won't have
to write another venting email, but i'm not sure...haven't read the news
yet today. Talking about my KS letter kinda charged me up, so maybe
i'll do that today. I'll send it to you when (if) it gets done.

Later
-Timmay

PS: http://www.venganza.org/

When/if i do that kansas letter, i'll be sure to post it here.

Questioning link time!!!!!!
Let the proverbial flood gates open....too soon?
Who knew Trevor was so magical?
The Supreme Court won't listen to cases about god in the pledge of allegiance or other touchy subjects, but they will listen to this?

Back to the mindless toil that is my job...
Later

Extremely Random

2005-09-25T23:17:00.000-04:00

I have the theme song to the old Nickelodeon show "Roundhouse" stuck in my head.

"...you know what i'm sayin...music and the fun never ends....down at the Roundhouse!"

Pissed off

2005-09-22T13:17:00.000-04:00

I just wrote a whole bunch of crap and the internet ate it.

I will update this later, when i'm not ready to walk upstairs and throw this laptop out a window.

Ask and ye shall receive

2005-09-22T12:37:00.000-04:00

Yeah, so....hey. How's it goin? Whatchoo been up to? Me? Nothin much, just work, you know how that goes. So...uhh....you...you been reading any other blogs since mine? I mean, it's ok if you did, i wasn't around and you had to live your own life. Hopefully you can come back to me in the end, but i totally understand if that can't work out. Well, i'll let you decide....talk to you later. Bye.

Not quite a year, but better late than never. Danrunt told me at our latest bingo excursion that i needed to update this thing. So i am.

Work sucks, as it does for everyone else in America. Started my 4th year at Election 2004 U., only 2 or so more years left....hopefully. That's the magic of getting your PhD...it's not up to you when you're done. Eventually your boss hands down a memo that says, "Look for a job." I'm shooting for December 2007 (5.5 years total), because i want to apply for a postdoc whose deadline is every January. It's mixing science with public policy work down in DCizzle working with either the executive (DoD, State, DHS, etc.) or the legislative branch (Rep's). Sounds pretty cool, plus it's only 1 year with a possible 1-year renewal. That way, i can find out if i hate it or not BEFORE i make it my life's work for the next 50 years.

I'm gonna try to talk my advisor into letting me take Russian and possibly Arabic next semester so that i look even better on paper for the application process. Need to have some "intelligence capital" to expend for the face-to-face interviews when they see me. (Haven't decided what's going to become of the metal....). I'm also going to try to bring up my whole "graduation scheme" of Dec 2007. We'll see how that goes, i'm not too hopeful. Although (1) i have bugged him for stuff and gotten it (2 new computers for our lab) and (2) i don't care any more, so i've got that goin for me....which is nice. As long as i have a set plan with goals in mind, it should go better than expected, but it's still venturing into the unknown.

Been reading a lot. It's amazing how much reading i actually get done while walking places. Efficiency experts should look into that. Walking to work was a 10-15 minute period of nothingness (well, just exercise). Now, i get through like 7-10 pages in my walk...which adds up. Finished Watership Down...didn't like it. Read a whole bunch of other stuff. Just finished No Safe Place by Richard North Patterson; picked it up in a supermarket about 5/6 years ago, impulse buy. Finally got around to reading it and it was surprisingly good. It's about this Senator from NJ, Kerry Kilcannon, running for the Democratic nomination for Prez. Got to "see" the behind-the-scenes dealings and goings-on of a campaign. The author also, from what i've read, picks a pet topic for his novel and kinda runs with it. This one was about gun control and abortion. The first chapter is this guy going into an abortion clinic in Kenmore Square and shoots up the place. (I learned that 'abortionist' is a word...who knew?).

Now i'm reading a book Patterson read as background for NSP about how power in Washington works; I like to think of it as Government for Dummies. The Power Game by Hedrick Smith is a ginormous tome of a book that seems like something kids would have to read for AP Gov't or Intro PoliSci or something. But, because i'm retarded, i'm reading it for fun. Practice for when i get there.

Not really sure what else is goin on. Slowly nursing myself from a CivIII addiction and prepping my body and mind for a new CivIV addiction, which comes out Oct 24. Lots of games are coming out before xmas that i'm going to need or need to ask for: XMen Legends II ("game over" to my social life...see what i did there?) and Batallion Wars to name a couple. My electric bill is going to be ridonkulous. Might need to get my required Yale 2005 package--a new phone and an IPod. We'll see.

Speaking of xmas, i just bought my flights "home" for xmas...which is weird since i've never had to fly anywhere for a holiday before. I bought them Monday...from JetBlue....who I loved when i flew them earlier this year, but recent events made me less than thrilled. I watched it unfold on television...live. Only news from LA would have a helicopter follow around an injured airplane. I thought to myself...what happens when this does land? There is a possibility that in can crash and burn and lots of people will die on live television. Kinda messed up. I flipped between MSNBC and NBC (I am a GE whore, i think they implanted something in me while my mom was pregnant and working there) to watch the Martha Stewart Apprentice show, a seeming plane crash in its own right. She got off of house arrest Sept 1st. Since then and now she started a daytime talk show (where Diddy, nee P. Diddy/Puff Daddy/Puffy/etc., taught her to rap) and a reality show. It was better than Donald Trump's mainly because he's so arrogant and grating and says "huge" wrong. There's no "you're fired" though, which is the main reason i watched. She says something "nice" and then pens a cordial goodbye letter to them. It wouldn't be any other way....

So it's been a while

2004-11-09T11:02:00.000-05:00

Sue me.

I guess i was so wrapped up in the election that i didn't post anything on this site that i use to rant about the election. Go figure.

Short update: I've still been eating a lot of Quizno's. Rabbits are still hopping, but now they're trying to fight a war with the evil fascist rabbits. Decemberists concert was amazing, of course. Red sox won. I believe that next year's cheer whenever we play the Yankees will be "2004". You've heard it here first....look for it. XMen Legends is the best game ever (i was addicted for two weeks straight--luckily i was sick, see below--and beat it). I went through withdrawl for about 4 days.

I got wicked sick (103.5 F fever for 5 days sick). Actually went to the doctor (big thing for me) because i was worried i had the flu. He told me essentially two things: (1) "When we say 'the flu' we mean 'influenza'" (thanks asshole) and (2) "Take tylenol and drink water". That's why i don't go to the doctor--they're patronizing and tell you things you already know. Thank god i have insurance because if i paid for that i would have gone ballistic. I think all medical students are required to take a course in "Student Medicine" that consists of 14 weeks of asking what's wrong, promptly ignoring it, and the prescribing tylenol and water.

Saw David Sedaris at the Shubert in New Haven...wicked funny. You should read his books. Also, read Sarah Vowell's books, she's good too.

Dressed up as a pedophile for Halloween: tight jeans, mullet, fake mustache, ratty shirt, and fleece vest. All i needed was a bag of lollipops and a van full of puppies and i would have been the real deal.

Got a new computer that Allison built. Kicks ass. Wicked fast. Need to get sentence function working.

And now to present day....
As you could probably tell, i've been avoiding one thing that you're expecting me to talk about. That whole...."election" thing. I still haven't been able to watch/read CNN or MSNBC or anything related to presidential politics. I need some time to heal before i can start thinking about what happened.

All i have to do now is look forward to the 2006 Connecticut gubernatorial race and the 2008 Democratic nomination. Look for my speculatory guesses on who's in and who's out. (Wow...that sounds like an E! special teaser).

In the news today, people are talking about who's going to run for the head of the DNC once McAuliffe's term ends early next year. Howard Dean's name has been dropped, but he would have to pledge to stay at the post the entire 4 years, which would rule out a Dean run in 2008. I doubt he'd run in 2008 anyway, but we'll see what happens. See, even when the presidential election stuff is over (and doesn't go your way) there are still a ton of other political things to get enthralled by.

Ok, i'll try to be better at this. I promise.

APowers222: Today's Headline: God to Floridians, "Don't fuck this up"

2004-09-27T15:13:00.000-04:00

My friend sent me this bit of internet-y goodness today.

So i think my friend's car got stolen outside of my apartment the other night, which is cool. At first we thought the NHPD impounded it for back parking tickets, but after they said they didn't have it we got a little worried. Now he has to call every tow company in the area to see if some random person had it towed before he can put in a stolen car report with the police. I thought i had bad luck....

I had Quizno's again yesterday. (They have a pepper bar...that's for Jondiehl). I'm fully addicted to quizno's...it's sad. It started in Colorado. Nothing starts in Colorado....except South Park and cheap beer.

I started reading my book again--"Watership Down" by Douglas Adams. From all of the reviews i've read, this book is sposta be one of the best adventures there is...everyone's favorite book. I just want to know when it gets good. I'm 150 pages into it (out of ~500) and so far a bunch of rabbits have hopped over a field....a couple of miles, but still a field. Too bad i have to finish a book once i start reading it. For their sakes they better do more than hippity-hop for 350 pages.

Going to a Decemberists concert up in Northampton, MA tomorrow night with Adeff. Should be good. Can't take their cd out of my car....it's so amazing.

Ok...need to find something else to do at work.

Mini-Rant

2004-09-15T09:26:00.000-04:00

(A) I just got an email to refinance my home "the Christian way". Does that mean I have to molest the loan officer's child?

(B) Plus, if I have to hear the jesus couple on Amazing Race pray to win a challenge one more time, I'm going to go ballistic. I wonder if they end up winning they'll give the money to charity since god essentially made them win...if not all, will they tithe it (before taxes of course since god pays no taxes...taxes that pay for things...that help communities...that regular people have to pay more for since one of the largest landholders in the countries doesn't have to pay taxes....)

Ok...rant over.

Leave it to scientists...

2004-09-08T13:32:00.000-04:00

Only a group of scientists would get together to answer the age old question, "How much beer is in a keg?" This site also looks inside other things to find out exactly "How much is in a ?" The magic of gradstudents with too much time on their hands.

RNC=Really No Commotion

2004-09-01T14:42:00.000-04:00

My advisor and I went down to NYC on Monday night to protest the Republican National Convention. He had read something in The Nation about "Light Up New York", which was a silent, individual protest thought up by the guy who "invented" the I heart NY slogan (Glazer, I think his name is). People were supposed to bring flashlights, candles, lanterns, anything that made a light and walk around NYC. So being the only liberals in our lab, we both decided to go.
Usually driving from New Haven to NYC during rush hour is a painful experience. Apparently, everyone is completely avoiding New York this week just like they did in Boston last month. No one wants to deal with the fact that the city is overrun with elephants for the week. It was smooth sailing the whole way. (Except for stopping at McDonald's on the highway...they jooked us out of a large fry...dammmmnnnn youuuu McDonald's!!!!!!!!!!!!!!!!)
We heard on NPR (told you we were liberal) that there was a march from the UN headquarters, through Manhattan, and ending at Madison Square Garden. It was "impromptu" (inasmuch as a protest march with hundreds of people can be spontaneous) even though they ok'd their route with police. Towards the end some guy attacked a city cop on a scooter so the police laid the smack down and broke it up. We also heard a story about people getting arrested left and right for innocuous offenses like taking pictures of the protests, city streets, and cops arresting protesters. They took pictures in order to make sure there was no police brutality and the protests were peaceful.
Upon hearing this in the car ride down, we thought we were going to see a lot of exciting things. Protests, marching, yelling of witty rhymes....We parked near Central Park and took the subway into Penn Station. Walking around Penn there were cops as far as the eye could see--city cops, staties, K9, army, national guard, secret service--with and without machine guns. Pretty unnerving to walk around a public train station and have a cop or a camera trace your every move and be ready to shoot you with an automatic weapon at will. Let's hope no one throws a snowball with a rock inside or else they'll be learning about the New York Massacre and Crispus Attucks, Jr. in the generations to come.
We come up from the station and onto 7th Avenue. Roadblocks, more cops, checkpoints everywhere. You even need credentials to walk on the sidewalks. What we didn't see was a protest. We knew that the UN march had already been broken up, but we figured there might be more flashlighters walking around lighting up New York. We walked down 33rd(?...can't really remember) Street....nothing but cops and roadblocks. More walking...more cops...no protests.
Walking to Herald Square and the ginormous Macy's on 34th we saw people on the corner talking to the passerbys and waving. Finally...some action. We walk up, flashlights in hand, phrases to yell floating in our heads, only to find that it's a bunch of interns for MSNBC trying to get an audience together for their live taping of Hardball in the middle of the square. We decide "what the hell" and head over for a while. With Matthews was JC Watts (GOP rising star and ex-congressman from OK), Joe Scarborough (of Scarborough County and ex-GOP congressman from FL fame), and two media schmos (some guy from Newsweek and some lady from somewhere).
They're not the exciting part of this story though (shocker). We were behind the panel of guests by about 20 feet or so and some people next to us started yelling anti-Bush things and reacting to the RNC coverage, one guy in particular was being rather vocal. A producer from MSNBC came out of the makeshift control room and told the kid to be quiet, who then retorted that he has a right to freedom of speech and that he can't take it from him. The producer then threatened getting an officer to arrest him and he said fine because he had a right to say what he wanted. He wasn't swearing or anything, just yelling something every couple of minutes whenever something stupid was said at the RNC.
Anyway the cop came up, had a little talk with those involved, went to get backup, and then came onto the staging where we were all standing. Now the talking got a lot sterner. During this an attractive MSNBC staffer came up to me and asked if I wanted to go down and watch the show from the pit right behind Matthews ("You can see better and you'll be on tv!", she beamed with her clipboard and headset). I thought to myself...I can see fine here...and then it clicked. She's trying to move us away from behind the panel. So we fought the man and stayed...quietly and without our cameras or flashlights brandished so as to avoid arrest.
After getting bored with Hardball, we walked around some more and saw a major police blockade. A guy in front of us tried to take a picture of it and the cop said, "You can't take pictures here." He then asked where he could take pictures and was told again "You can't take pictures here." My camera remained tucked away for the remainder of the trip.
Headed up to Times Square where we thought that there must be some sort of protest or anything at all. Nope. Nothing at all. Just cops. After yet another disappointment we called it a night and headed back to the car where we turned on our flashlights, waved them into the sky and some apartment windows and left. It was just our way of fighting The Man. With all the cops present and lights shining through their windows, the tenants probably thought our Man-fighting was an air raid test to protect against the Commies...errr, Islamic Fundamentalists...err, Insert Group Here.
We couldn't believe how anti-climactic our visit was. We figured the streets would be lined with dead-ins and painted signs. Oh well. Maybe protesters only work during the day in order to make it to their Meetups at night. I'm glad I went though. I got to experience first hand NYC in lock-down and how it infringes on personal liberties and freedoms. Orwell's world is an exaggeration...either that or he was 40 years off.

It may be 2004 in real life, but the church still thinks it's 1204

2004-08-20T10:35:00.000-04:00

This is just another reason for why the catholic church is so out of touch with mainstream anything. Who cares if this girl may die if she eats wheat? If jesus didn't eat a rice wafer, then, by god, she can't eat a rice wafer. Wait....Didn't jesus actually have bread and not wafers? Hmm, i'll have to take that contradiction as fact in order to prove my faith. I guess this whole argument is based on the assumption that the bible is a history text and not just a book of fables that can be used as an example of morality. Thank god i gave up religion for lent all those years ago or else i would have to start thinking for myself later in life...or call up Robertson and Falwell for my 25-year reprogramming tune-up.

Links, glorious links!

2004-08-03T10:52:00.000-04:00

Wow...today is a fantastic stupid news day. Here's a few links to keep your fun-filled work day full of fun:
Doing what Tiggers do best
Just gimme a week or two...
The US takes a page out of third-world medical books
For those with a conservative palette
Fighting discrimination one value meal at a time

The Secretary who cried al Qaeda

2004-08-03T10:32:00.000-04:00

Apparently someone needs to brush up on their kiddie stories....
As cliche as it is for a liberal to allude to a Michael Moore documentary, more and more every day I can't help but agree that Americans are being beat to a psychological pulp. If it's not an orange alert one day, it's a "generalized warning" the next.
My new favorite fear-mercial is the Coppertone campaign about just walking outside and getting skin cancer. (It's actually one of their Flash animations on their home page). This woman talks about how her mother used to let her play outside without suntan lotion, and then when she was 40-something she developed skin cancer. Now she slathers her kids, her husband, herself, and everyone she knows (her dog Killer?) with Coppertone brand lotion (but of course) before they step out of her panic room she calls a home.

Entry #2194 on "Why Republicans are out of touch with Americans"...

2004-07-30T13:25:00.000-04:00

According to reports today, former Governor of the Commonwealth of Pennsylvania and presently the first Secretary of Homeland Security Tom Ridge will step down after the November election, regardless of the outcome. The reasons he cites are that "he is worn out from the massive reorganization of government and needs to earn money in the private sector to put his teenage children through college." He's worried about being able to "comfortably" put his kids through college....all two of them. The article also notes that public officials at Ridge's level can "easily earn millions of dollars each year in the private sector."

Included in the report is a snippit of his personal finances:

Salary as Governor from 1995-2001=$138316/year
Salary as Secretary from 2001-Present=$175700/year
Stocks and Funds=Between $122000 and $787000
House in Bethesda=$873000 (with a $784800 mortgage)

Let's compare this to a blue-collar, single-parent, two-child household in, say, Massachusetts. Hypothetically speaking, a middle-aged secretary at a job for 15 years makes ~$30000/year. (It's a little less, but we're giving ole Tommy Boy the benefit of the doubt). For those slow with division, the poor Secretary makes six times more than the poor secretary. One child went to a private university for ~$35000/year and received minimal federal aid because the parent made too much money. The other child is presently at a state school that is ~$10000/year. All parties involved had to take out interest-accruing loans, cash savings bonds, and use savings accounts to pay for school.

This family was never poverty-stricken by any standards: always had food on the table, always had clothes to wear, always had a roof above their heads, always had cars to get to work, etc. Bills were pretty much month-to-month, and there was not a whole lot of extra money for things. Vacations were rare. I would qualify that as "barely living comfortably". Sure, more money would have helped with expenses, but this family was doing just as well as every other blue-collar, single-income, middle-class family in America (if not better).

I find it disgusting that Ridge would use putting his kids through college as an excuse for leaving his post where he makes $175000 a year. If you're stressed out, just say so. If you hate your job, say so. If you don't think Bush will get re-elected and you're going to lose your job anyway, then say so (tactfully, or else you really will lose your job). But to say you can't afford 2 college tuitions as a member of the upper class...priceless.

When the collars pop, the panties drop...

2004-07-23T14:51:00.000-04:00

Since I go to a pretentious...err, prestigious university now, topics such as "rocking the upcollar" are commonplace. I was in a fraternity in college, and I don't do any of these things. Except maybe wear khaki shorts...and go to the bar...or drink at the house...and have a nickname...or four...and half-tuck....
But seriously, it sounds like this guy's got a southern stereotype of a fratdaddy. The east coast or northeastern fratdaddy is definitely different. It would involve gel-spiked hair (bleached tips are key) or a trucker hat off-kilter, a half-tucked patterned shirt, weathered jeans with optional petrol wash, and reefs. Pastel polo shirts with up-collar sufficiently rocked are starting to make their way up here, but i feel the patterned shirt will never be jarred from its spot on the pedestal. Pastels just aren't hambonish enough.

We'll See...

2004-07-20T18:19:00.000-04:00

Well, looks like I've decided to enter into the 21st century. Having to learn how to program and update my group's website has made me the most unlikely person to become computer savvy. We'll see if i stick with it or not.
I'm not sure on the exact format yet. It'll most likely turn into a collection of my (hopefully humorous) takes on life and random social commentaries. Things that interest me at the moment--be it politically, musically, scientifically, fictionally, non-fictionally, etc.--will also make cameo appearances.